Twenty-one biosciences) in a total volume of

Twenty-one samples were collected from various parts
of western Ghats (Table 1 for details). The 21 samples are grouped in four
population of Salacia chinensis L., Salacia macrosperma Wight., Salacia fruticosa Lawson., Salacia oblonga Wall. ex Wight &
Arn.

 

DNA
isolation, RAPD and ISSR reaction

Best services for writing your paper according to Trustpilot

Premium Partner
From $18.00 per page
4,8 / 5
4,80
Writers Experience
4,80
Delivery
4,90
Support
4,70
Price
Recommended Service
From $13.90 per page
4,6 / 5
4,70
Writers Experience
4,70
Delivery
4,60
Support
4,60
Price
From $20.00 per page
4,5 / 5
4,80
Writers Experience
4,50
Delivery
4,40
Support
4,10
Price
* All Partners were chosen among 50+ writing services by our Customer Satisfaction Team

              Genomic
DNA was isolated according to Stange et al. (1998) protocol. DNA was quantified using NanoDrop 2000
Spectrophotometer (Thermo Fisher Scientific) and diluted to 25 ng for use in polymerase
chain reaction (PCR). Reaction mixture contained 100 uM of each dNTPs (Merck
biosciences), 5 uMole of primer (Sigma,USA), 0.5 Unit of Taq DNA polymerase
(Merck biosciences) and 1x Taq buffer (Merck biosciences) in a total volume of
20 ul. ISSR-PCR amplification was carried out for 40 cycles, with initial
denaturation for 5 minutes at 94°C, followed by cyclic process of denaturation
for 1-minute at 94oC, annealing at temperature standardized for each
primer (Table 2) for 1 minutes and extension at 72°C for 1 minutes, and final
extension at 72 °C for 5 minutes in Applied Biosystems Veriti Thermal Cycler. For
RAPD-PCR, the protocol was similar to ISSR except for the annealing temperature
which was 36°C for all the primers. For the PCR amplification of the ITS
sequence, primers ITS4-TCCTCCGCTTATTGATATGC and ITS5- GGAAGTAAAAGTCGTAACAAGG
designed by WHITE (1990) were used. ITS amplification was carried for 28
cycles with initial denaturation at 95°C for 1 minute 30 seconds, cyclic
process of denaturation at 95°C for 30 seconds, annealing at 42°C for 1 minute,
extension at72°C for 1 minute and final extension 72°C for 3 minutes. Amplified
products were separated in 1.8% agarose gel containing ethidium bromide using
1x TBE buffer. DNA fragments were visualized under UV light. The band patterns
were photographed using Gel Doc™ XR (Bio- Rad).

 

Phylogenetic analysis of ITS sequence

              The
amplified products were sent to Chromous biotech, Bangalore for sequencing. The
sequence generated were submitted to NCBI database. For phylogenetic
analysis of ITS sequence MEGA 5 (Tamura et al. 2011) software was used. Nineteen samples from current
study and an outgroup sequence was used for sequence analysis. The multiple
sequence alignment was performed using CLUSTAL W, version 1.6 (Thompson et al. 2002). Using MEGA 5 best-fit Model-test was performed and
model with the lowest Bayesian Information Criterion (BIC) score was selected
for further analysis. The Maximum Likelihood tree was constructed using the
best fit model with least BIC score.

 

Data
collection and Analysis

              The
banding patterns obtained from RAPD and ISSR were scored as present (1) or
absent (0) and binary matrix was created for RAPD and ISSR primers. The
polymorphic information content (PIC) proposed by Roldàn-Ruiz et al.
(2000), marker index (MI) described by Varshney et al. (2007) and resolving power (RP) by Prevost and Wilkinson
(1999) of each marker was calculated and multiplex ratio  was 
calculates as product of total number monomorphic and polymorphic loci/
number of assays.

              POPGENE
(Yeh et al. 1999)was used to calculate various paraments such as
percentage of polymorphic band, observed number of alleles (na), effective
number of alleles (ne), Shannon’s information index (I) and Nei’s gene
diversity (H) total heterozygosity (Ht), average heterozygosity (Hs) and gene
flow (Nm) between the populations and among the individuals within each
population. The similarity matrix was subjected to cluster analysis by
unweighted pair group method for arithmetic mean (UPGMA) and a dendrogram was
generated.

              GenAlEx6
(Peakall and Smouse
2006) was also used to calculate Principal Coordinates Analysis (PCoA) that
plots the relationship between distance matrix elements based on their first
two principal coordinates. The product-moment correlation (r) based on Mantel Z
value was computed to measure the degree of relationship between similarity
index matrices produced by any two-marker systems. The RAPD, ISSR and ITS data
were subjected to a hierarchical analysis of molecular variance(AMOVA), as
described by Excoffier et al. (1992).